ID: 971143331

View in Genome Browser
Species Human (GRCh38)
Location 4:23948529-23948551
Sequence GCCTCCTAGAGAGAAACCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971143331_971143336 0 Left 971143331 4:23948529-23948551 CCTTTGGTTTCTCTCTAGGAGGC No data
Right 971143336 4:23948552-23948574 CCTTTGGGCTGAAATCTCACTGG No data
971143331_971143338 24 Left 971143331 4:23948529-23948551 CCTTTGGTTTCTCTCTAGGAGGC No data
Right 971143338 4:23948576-23948598 AAAGGAAGTACTTAGAGACTTGG No data
971143331_971143337 6 Left 971143331 4:23948529-23948551 CCTTTGGTTTCTCTCTAGGAGGC No data
Right 971143337 4:23948558-23948580 GGCTGAAATCTCACTGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971143331 Original CRISPR GCCTCCTAGAGAGAAACCAA AGG (reversed) Intergenic
No off target data available for this crispr