ID: 971144667

View in Genome Browser
Species Human (GRCh38)
Location 4:23963728-23963750
Sequence AAAGCAATTATGCGGTTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971144667_971144676 18 Left 971144667 4:23963728-23963750 CCTGCTAACCGCATAATTGCTTT No data
Right 971144676 4:23963769-23963791 GTTGTCCTGCAGTAGATCCTGGG No data
971144667_971144669 -4 Left 971144667 4:23963728-23963750 CCTGCTAACCGCATAATTGCTTT No data
Right 971144669 4:23963747-23963769 CTTTCATGAACCCCCTTTCCTGG No data
971144667_971144678 27 Left 971144667 4:23963728-23963750 CCTGCTAACCGCATAATTGCTTT No data
Right 971144678 4:23963778-23963800 CAGTAGATCCTGGGTGCTCCTGG No data
971144667_971144675 17 Left 971144667 4:23963728-23963750 CCTGCTAACCGCATAATTGCTTT No data
Right 971144675 4:23963768-23963790 GGTTGTCCTGCAGTAGATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971144667 Original CRISPR AAAGCAATTATGCGGTTAGC AGG (reversed) Intergenic