ID: 971144668

View in Genome Browser
Species Human (GRCh38)
Location 4:23963736-23963758
Sequence GGTTCATGAAAGCAATTATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971144668_971144676 10 Left 971144668 4:23963736-23963758 CCGCATAATTGCTTTCATGAACC No data
Right 971144676 4:23963769-23963791 GTTGTCCTGCAGTAGATCCTGGG No data
971144668_971144675 9 Left 971144668 4:23963736-23963758 CCGCATAATTGCTTTCATGAACC No data
Right 971144675 4:23963768-23963790 GGTTGTCCTGCAGTAGATCCTGG No data
971144668_971144678 19 Left 971144668 4:23963736-23963758 CCGCATAATTGCTTTCATGAACC No data
Right 971144678 4:23963778-23963800 CAGTAGATCCTGGGTGCTCCTGG No data
971144668_971144680 27 Left 971144668 4:23963736-23963758 CCGCATAATTGCTTTCATGAACC No data
Right 971144680 4:23963786-23963808 CCTGGGTGCTCCTGGAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971144668 Original CRISPR GGTTCATGAAAGCAATTATG CGG (reversed) Intergenic