ID: 971144672

View in Genome Browser
Species Human (GRCh38)
Location 4:23963759-23963781
Sequence ACTGCAGGACAACCAGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971144672_971144684 17 Left 971144672 4:23963759-23963781 CCCTTTCCTGGTTGTCCTGCAGT No data
Right 971144684 4:23963799-23963821 GGAAAGCTGGCCAAAGGAATGGG No data
971144672_971144683 16 Left 971144672 4:23963759-23963781 CCCTTTCCTGGTTGTCCTGCAGT No data
Right 971144683 4:23963798-23963820 TGGAAAGCTGGCCAAAGGAATGG No data
971144672_971144680 4 Left 971144672 4:23963759-23963781 CCCTTTCCTGGTTGTCCTGCAGT No data
Right 971144680 4:23963786-23963808 CCTGGGTGCTCCTGGAAAGCTGG No data
971144672_971144681 11 Left 971144672 4:23963759-23963781 CCCTTTCCTGGTTGTCCTGCAGT No data
Right 971144681 4:23963793-23963815 GCTCCTGGAAAGCTGGCCAAAGG No data
971144672_971144685 26 Left 971144672 4:23963759-23963781 CCCTTTCCTGGTTGTCCTGCAGT No data
Right 971144685 4:23963808-23963830 GCCAAAGGAATGGGAAATGAAGG No data
971144672_971144678 -4 Left 971144672 4:23963759-23963781 CCCTTTCCTGGTTGTCCTGCAGT No data
Right 971144678 4:23963778-23963800 CAGTAGATCCTGGGTGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971144672 Original CRISPR ACTGCAGGACAACCAGGAAA GGG (reversed) Intergenic
No off target data available for this crispr