ID: 971144674

View in Genome Browser
Species Human (GRCh38)
Location 4:23963765-23963787
Sequence GGATCTACTGCAGGACAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971144674_971144678 -10 Left 971144674 4:23963765-23963787 CCTGGTTGTCCTGCAGTAGATCC No data
Right 971144678 4:23963778-23963800 CAGTAGATCCTGGGTGCTCCTGG No data
971144674_971144685 20 Left 971144674 4:23963765-23963787 CCTGGTTGTCCTGCAGTAGATCC No data
Right 971144685 4:23963808-23963830 GCCAAAGGAATGGGAAATGAAGG No data
971144674_971144680 -2 Left 971144674 4:23963765-23963787 CCTGGTTGTCCTGCAGTAGATCC No data
Right 971144680 4:23963786-23963808 CCTGGGTGCTCCTGGAAAGCTGG No data
971144674_971144681 5 Left 971144674 4:23963765-23963787 CCTGGTTGTCCTGCAGTAGATCC No data
Right 971144681 4:23963793-23963815 GCTCCTGGAAAGCTGGCCAAAGG No data
971144674_971144683 10 Left 971144674 4:23963765-23963787 CCTGGTTGTCCTGCAGTAGATCC No data
Right 971144683 4:23963798-23963820 TGGAAAGCTGGCCAAAGGAATGG No data
971144674_971144684 11 Left 971144674 4:23963765-23963787 CCTGGTTGTCCTGCAGTAGATCC No data
Right 971144684 4:23963799-23963821 GGAAAGCTGGCCAAAGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971144674 Original CRISPR GGATCTACTGCAGGACAACC AGG (reversed) Intergenic
No off target data available for this crispr