ID: 971144677

View in Genome Browser
Species Human (GRCh38)
Location 4:23963774-23963796
Sequence GAGCACCCAGGATCTACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971144677_971144685 11 Left 971144677 4:23963774-23963796 CCTGCAGTAGATCCTGGGTGCTC No data
Right 971144685 4:23963808-23963830 GCCAAAGGAATGGGAAATGAAGG No data
971144677_971144683 1 Left 971144677 4:23963774-23963796 CCTGCAGTAGATCCTGGGTGCTC No data
Right 971144683 4:23963798-23963820 TGGAAAGCTGGCCAAAGGAATGG No data
971144677_971144684 2 Left 971144677 4:23963774-23963796 CCTGCAGTAGATCCTGGGTGCTC No data
Right 971144684 4:23963799-23963821 GGAAAGCTGGCCAAAGGAATGGG No data
971144677_971144688 24 Left 971144677 4:23963774-23963796 CCTGCAGTAGATCCTGGGTGCTC No data
Right 971144688 4:23963821-23963843 GAAATGAAGGTGTCATAGTCGGG No data
971144677_971144687 23 Left 971144677 4:23963774-23963796 CCTGCAGTAGATCCTGGGTGCTC No data
Right 971144687 4:23963820-23963842 GGAAATGAAGGTGTCATAGTCGG No data
971144677_971144681 -4 Left 971144677 4:23963774-23963796 CCTGCAGTAGATCCTGGGTGCTC No data
Right 971144681 4:23963793-23963815 GCTCCTGGAAAGCTGGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971144677 Original CRISPR GAGCACCCAGGATCTACTGC AGG (reversed) Intergenic
No off target data available for this crispr