ID: 971144679

View in Genome Browser
Species Human (GRCh38)
Location 4:23963786-23963808
Sequence CCAGCTTTCCAGGAGCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971144679_971144688 12 Left 971144679 4:23963786-23963808 CCTGGGTGCTCCTGGAAAGCTGG No data
Right 971144688 4:23963821-23963843 GAAATGAAGGTGTCATAGTCGGG No data
971144679_971144684 -10 Left 971144679 4:23963786-23963808 CCTGGGTGCTCCTGGAAAGCTGG No data
Right 971144684 4:23963799-23963821 GGAAAGCTGGCCAAAGGAATGGG No data
971144679_971144690 28 Left 971144679 4:23963786-23963808 CCTGGGTGCTCCTGGAAAGCTGG No data
Right 971144690 4:23963837-23963859 AGTCGGGTGAAGAGTAAGGAAGG No data
971144679_971144687 11 Left 971144679 4:23963786-23963808 CCTGGGTGCTCCTGGAAAGCTGG No data
Right 971144687 4:23963820-23963842 GGAAATGAAGGTGTCATAGTCGG No data
971144679_971144689 24 Left 971144679 4:23963786-23963808 CCTGGGTGCTCCTGGAAAGCTGG No data
Right 971144689 4:23963833-23963855 TCATAGTCGGGTGAAGAGTAAGG No data
971144679_971144685 -1 Left 971144679 4:23963786-23963808 CCTGGGTGCTCCTGGAAAGCTGG No data
Right 971144685 4:23963808-23963830 GCCAAAGGAATGGGAAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971144679 Original CRISPR CCAGCTTTCCAGGAGCACCC AGG (reversed) Intergenic