ID: 971144680

View in Genome Browser
Species Human (GRCh38)
Location 4:23963786-23963808
Sequence CCTGGGTGCTCCTGGAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971144668_971144680 27 Left 971144668 4:23963736-23963758 CCGCATAATTGCTTTCATGAACC No data
Right 971144680 4:23963786-23963808 CCTGGGTGCTCCTGGAAAGCTGG No data
971144671_971144680 5 Left 971144671 4:23963758-23963780 CCCCTTTCCTGGTTGTCCTGCAG No data
Right 971144680 4:23963786-23963808 CCTGGGTGCTCCTGGAAAGCTGG No data
971144673_971144680 3 Left 971144673 4:23963760-23963782 CCTTTCCTGGTTGTCCTGCAGTA No data
Right 971144680 4:23963786-23963808 CCTGGGTGCTCCTGGAAAGCTGG No data
971144670_971144680 6 Left 971144670 4:23963757-23963779 CCCCCTTTCCTGGTTGTCCTGCA No data
Right 971144680 4:23963786-23963808 CCTGGGTGCTCCTGGAAAGCTGG No data
971144672_971144680 4 Left 971144672 4:23963759-23963781 CCCTTTCCTGGTTGTCCTGCAGT No data
Right 971144680 4:23963786-23963808 CCTGGGTGCTCCTGGAAAGCTGG No data
971144674_971144680 -2 Left 971144674 4:23963765-23963787 CCTGGTTGTCCTGCAGTAGATCC No data
Right 971144680 4:23963786-23963808 CCTGGGTGCTCCTGGAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971144680 Original CRISPR CCTGGGTGCTCCTGGAAAGC TGG Intergenic
No off target data available for this crispr