ID: 971144684

View in Genome Browser
Species Human (GRCh38)
Location 4:23963799-23963821
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971144679_971144684 -10 Left 971144679 4:23963786-23963808 CCTGGGTGCTCCTGGAAAGCTGG No data
Right 971144684 4:23963799-23963821 GGAAAGCTGGCCAAAGGAATGGG No data
971144674_971144684 11 Left 971144674 4:23963765-23963787 CCTGGTTGTCCTGCAGTAGATCC No data
Right 971144684 4:23963799-23963821 GGAAAGCTGGCCAAAGGAATGGG No data
971144670_971144684 19 Left 971144670 4:23963757-23963779 CCCCCTTTCCTGGTTGTCCTGCA No data
Right 971144684 4:23963799-23963821 GGAAAGCTGGCCAAAGGAATGGG No data
971144673_971144684 16 Left 971144673 4:23963760-23963782 CCTTTCCTGGTTGTCCTGCAGTA No data
Right 971144684 4:23963799-23963821 GGAAAGCTGGCCAAAGGAATGGG No data
971144677_971144684 2 Left 971144677 4:23963774-23963796 CCTGCAGTAGATCCTGGGTGCTC No data
Right 971144684 4:23963799-23963821 GGAAAGCTGGCCAAAGGAATGGG No data
971144671_971144684 18 Left 971144671 4:23963758-23963780 CCCCTTTCCTGGTTGTCCTGCAG No data
Right 971144684 4:23963799-23963821 GGAAAGCTGGCCAAAGGAATGGG No data
971144672_971144684 17 Left 971144672 4:23963759-23963781 CCCTTTCCTGGTTGTCCTGCAGT No data
Right 971144684 4:23963799-23963821 GGAAAGCTGGCCAAAGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type