ID: 971144685

View in Genome Browser
Species Human (GRCh38)
Location 4:23963808-23963830
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971144670_971144685 28 Left 971144670 4:23963757-23963779 CCCCCTTTCCTGGTTGTCCTGCA No data
Right 971144685 4:23963808-23963830 GCCAAAGGAATGGGAAATGAAGG No data
971144677_971144685 11 Left 971144677 4:23963774-23963796 CCTGCAGTAGATCCTGGGTGCTC No data
Right 971144685 4:23963808-23963830 GCCAAAGGAATGGGAAATGAAGG No data
971144673_971144685 25 Left 971144673 4:23963760-23963782 CCTTTCCTGGTTGTCCTGCAGTA No data
Right 971144685 4:23963808-23963830 GCCAAAGGAATGGGAAATGAAGG No data
971144672_971144685 26 Left 971144672 4:23963759-23963781 CCCTTTCCTGGTTGTCCTGCAGT No data
Right 971144685 4:23963808-23963830 GCCAAAGGAATGGGAAATGAAGG No data
971144674_971144685 20 Left 971144674 4:23963765-23963787 CCTGGTTGTCCTGCAGTAGATCC No data
Right 971144685 4:23963808-23963830 GCCAAAGGAATGGGAAATGAAGG No data
971144671_971144685 27 Left 971144671 4:23963758-23963780 CCCCTTTCCTGGTTGTCCTGCAG No data
Right 971144685 4:23963808-23963830 GCCAAAGGAATGGGAAATGAAGG No data
971144679_971144685 -1 Left 971144679 4:23963786-23963808 CCTGGGTGCTCCTGGAAAGCTGG No data
Right 971144685 4:23963808-23963830 GCCAAAGGAATGGGAAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type