ID: 971144687

View in Genome Browser
Species Human (GRCh38)
Location 4:23963820-23963842
Sequence GGAAATGAAGGTGTCATAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971144679_971144687 11 Left 971144679 4:23963786-23963808 CCTGGGTGCTCCTGGAAAGCTGG No data
Right 971144687 4:23963820-23963842 GGAAATGAAGGTGTCATAGTCGG No data
971144682_971144687 1 Left 971144682 4:23963796-23963818 CCTGGAAAGCTGGCCAAAGGAAT No data
Right 971144687 4:23963820-23963842 GGAAATGAAGGTGTCATAGTCGG No data
971144677_971144687 23 Left 971144677 4:23963774-23963796 CCTGCAGTAGATCCTGGGTGCTC No data
Right 971144687 4:23963820-23963842 GGAAATGAAGGTGTCATAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971144687 Original CRISPR GGAAATGAAGGTGTCATAGT CGG Intergenic