ID: 971144689

View in Genome Browser
Species Human (GRCh38)
Location 4:23963833-23963855
Sequence TCATAGTCGGGTGAAGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971144682_971144689 14 Left 971144682 4:23963796-23963818 CCTGGAAAGCTGGCCAAAGGAAT No data
Right 971144689 4:23963833-23963855 TCATAGTCGGGTGAAGAGTAAGG No data
971144686_971144689 1 Left 971144686 4:23963809-23963831 CCAAAGGAATGGGAAATGAAGGT No data
Right 971144689 4:23963833-23963855 TCATAGTCGGGTGAAGAGTAAGG No data
971144679_971144689 24 Left 971144679 4:23963786-23963808 CCTGGGTGCTCCTGGAAAGCTGG No data
Right 971144689 4:23963833-23963855 TCATAGTCGGGTGAAGAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971144689 Original CRISPR TCATAGTCGGGTGAAGAGTA AGG Intergenic