ID: 971144690

View in Genome Browser
Species Human (GRCh38)
Location 4:23963837-23963859
Sequence AGTCGGGTGAAGAGTAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971144686_971144690 5 Left 971144686 4:23963809-23963831 CCAAAGGAATGGGAAATGAAGGT No data
Right 971144690 4:23963837-23963859 AGTCGGGTGAAGAGTAAGGAAGG No data
971144679_971144690 28 Left 971144679 4:23963786-23963808 CCTGGGTGCTCCTGGAAAGCTGG No data
Right 971144690 4:23963837-23963859 AGTCGGGTGAAGAGTAAGGAAGG No data
971144682_971144690 18 Left 971144682 4:23963796-23963818 CCTGGAAAGCTGGCCAAAGGAAT No data
Right 971144690 4:23963837-23963859 AGTCGGGTGAAGAGTAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971144690 Original CRISPR AGTCGGGTGAAGAGTAAGGA AGG Intergenic