ID: 971145115

View in Genome Browser
Species Human (GRCh38)
Location 4:23968013-23968035
Sequence ACTGGAAGTAAGGAAGTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971145112_971145115 0 Left 971145112 4:23967990-23968012 CCTAGAAACAACAGAAGAGAAGA No data
Right 971145115 4:23968013-23968035 ACTGGAAGTAAGGAAGTACTTGG No data
971145111_971145115 1 Left 971145111 4:23967989-23968011 CCCTAGAAACAACAGAAGAGAAG No data
Right 971145115 4:23968013-23968035 ACTGGAAGTAAGGAAGTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971145115 Original CRISPR ACTGGAAGTAAGGAAGTACT TGG Intergenic
No off target data available for this crispr