ID: 971150452

View in Genome Browser
Species Human (GRCh38)
Location 4:24025837-24025859
Sequence AATTCAATGGGGAAAGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971150446_971150452 10 Left 971150446 4:24025804-24025826 CCAGGTGTAGGTGATGTATAAAA No data
Right 971150452 4:24025837-24025859 AATTCAATGGGGAAAGGAGGAGG No data
971150444_971150452 23 Left 971150444 4:24025791-24025813 CCTAAATATAACTCCAGGTGTAG No data
Right 971150452 4:24025837-24025859 AATTCAATGGGGAAAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971150452 Original CRISPR AATTCAATGGGGAAAGGAGG AGG Intergenic
No off target data available for this crispr