ID: 971150481

View in Genome Browser
Species Human (GRCh38)
Location 4:24026218-24026240
Sequence AACTGGGACTGGTGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971150481_971150492 18 Left 971150481 4:24026218-24026240 CCCACTTCCCACCAGTCCCAGTT No data
Right 971150492 4:24026259-24026281 TCATTCATTTGCATGATCTGTGG No data
971150481_971150493 19 Left 971150481 4:24026218-24026240 CCCACTTCCCACCAGTCCCAGTT No data
Right 971150493 4:24026260-24026282 CATTCATTTGCATGATCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971150481 Original CRISPR AACTGGGACTGGTGGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr