ID: 971151320

View in Genome Browser
Species Human (GRCh38)
Location 4:24035106-24035128
Sequence GCCACACATATACTATCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971151320_971151322 1 Left 971151320 4:24035106-24035128 CCGGGAGATAGTATATGTGTGGC No data
Right 971151322 4:24035130-24035152 AACACTTGTTGAAACTAACAGGG No data
971151320_971151323 12 Left 971151320 4:24035106-24035128 CCGGGAGATAGTATATGTGTGGC No data
Right 971151323 4:24035141-24035163 AAACTAACAGGGCAGTCCATAGG No data
971151320_971151321 0 Left 971151320 4:24035106-24035128 CCGGGAGATAGTATATGTGTGGC No data
Right 971151321 4:24035129-24035151 AAACACTTGTTGAAACTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971151320 Original CRISPR GCCACACATATACTATCTCC CGG (reversed) Intergenic
No off target data available for this crispr