ID: 971151321

View in Genome Browser
Species Human (GRCh38)
Location 4:24035129-24035151
Sequence AAACACTTGTTGAAACTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971151320_971151321 0 Left 971151320 4:24035106-24035128 CCGGGAGATAGTATATGTGTGGC No data
Right 971151321 4:24035129-24035151 AAACACTTGTTGAAACTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971151321 Original CRISPR AAACACTTGTTGAAACTAAC AGG Intergenic
No off target data available for this crispr