ID: 971151821 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:24041279-24041301 |
Sequence | CCCAGCAGGGAGGAGTTGGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
971151821_971151830 | 13 | Left | 971151821 | 4:24041279-24041301 | CCCTCCAACTCCTCCCTGCTGGG | No data | ||
Right | 971151830 | 4:24041315-24041337 | GGGCTGCATTTCTCCACCAAAGG | No data | ||||
971151821_971151829 | -7 | Left | 971151821 | 4:24041279-24041301 | CCCTCCAACTCCTCCCTGCTGGG | No data | ||
Right | 971151829 | 4:24041295-24041317 | TGCTGGGCACAGTTTAGAAAGGG | No data | ||||
971151821_971151828 | -8 | Left | 971151821 | 4:24041279-24041301 | CCCTCCAACTCCTCCCTGCTGGG | No data | ||
Right | 971151828 | 4:24041294-24041316 | CTGCTGGGCACAGTTTAGAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
971151821 | Original CRISPR | CCCAGCAGGGAGGAGTTGGA GGG (reversed) | Intergenic | ||
No off target data available for this crispr |