ID: 971151821

View in Genome Browser
Species Human (GRCh38)
Location 4:24041279-24041301
Sequence CCCAGCAGGGAGGAGTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971151821_971151830 13 Left 971151821 4:24041279-24041301 CCCTCCAACTCCTCCCTGCTGGG No data
Right 971151830 4:24041315-24041337 GGGCTGCATTTCTCCACCAAAGG No data
971151821_971151829 -7 Left 971151821 4:24041279-24041301 CCCTCCAACTCCTCCCTGCTGGG No data
Right 971151829 4:24041295-24041317 TGCTGGGCACAGTTTAGAAAGGG No data
971151821_971151828 -8 Left 971151821 4:24041279-24041301 CCCTCCAACTCCTCCCTGCTGGG No data
Right 971151828 4:24041294-24041316 CTGCTGGGCACAGTTTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971151821 Original CRISPR CCCAGCAGGGAGGAGTTGGA GGG (reversed) Intergenic
No off target data available for this crispr