ID: 971151829

View in Genome Browser
Species Human (GRCh38)
Location 4:24041295-24041317
Sequence TGCTGGGCACAGTTTAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971151823_971151829 -8 Left 971151823 4:24041280-24041302 CCTCCAACTCCTCCCTGCTGGGC No data
Right 971151829 4:24041295-24041317 TGCTGGGCACAGTTTAGAAAGGG No data
971151821_971151829 -7 Left 971151821 4:24041279-24041301 CCCTCCAACTCCTCCCTGCTGGG No data
Right 971151829 4:24041295-24041317 TGCTGGGCACAGTTTAGAAAGGG No data
971151817_971151829 27 Left 971151817 4:24041245-24041267 CCAAGGTCAAGAGGAAAATGAAG No data
Right 971151829 4:24041295-24041317 TGCTGGGCACAGTTTAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971151829 Original CRISPR TGCTGGGCACAGTTTAGAAA GGG Intergenic
No off target data available for this crispr