ID: 971151830

View in Genome Browser
Species Human (GRCh38)
Location 4:24041315-24041337
Sequence GGGCTGCATTTCTCCACCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971151823_971151830 12 Left 971151823 4:24041280-24041302 CCTCCAACTCCTCCCTGCTGGGC No data
Right 971151830 4:24041315-24041337 GGGCTGCATTTCTCCACCAAAGG No data
971151825_971151830 3 Left 971151825 4:24041289-24041311 CCTCCCTGCTGGGCACAGTTTAG No data
Right 971151830 4:24041315-24041337 GGGCTGCATTTCTCCACCAAAGG No data
971151824_971151830 9 Left 971151824 4:24041283-24041305 CCAACTCCTCCCTGCTGGGCACA No data
Right 971151830 4:24041315-24041337 GGGCTGCATTTCTCCACCAAAGG No data
971151827_971151830 -1 Left 971151827 4:24041293-24041315 CCTGCTGGGCACAGTTTAGAAAG No data
Right 971151830 4:24041315-24041337 GGGCTGCATTTCTCCACCAAAGG No data
971151821_971151830 13 Left 971151821 4:24041279-24041301 CCCTCCAACTCCTCCCTGCTGGG No data
Right 971151830 4:24041315-24041337 GGGCTGCATTTCTCCACCAAAGG No data
971151826_971151830 0 Left 971151826 4:24041292-24041314 CCCTGCTGGGCACAGTTTAGAAA No data
Right 971151830 4:24041315-24041337 GGGCTGCATTTCTCCACCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971151830 Original CRISPR GGGCTGCATTTCTCCACCAA AGG Intergenic
No off target data available for this crispr