ID: 971154638

View in Genome Browser
Species Human (GRCh38)
Location 4:24068332-24068354
Sequence CAGTATCTGCAGAAGCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971154634_971154638 28 Left 971154634 4:24068281-24068303 CCTCTGGAGGAGAGAACTAGAAG No data
Right 971154638 4:24068332-24068354 CAGTATCTGCAGAAGCCCAGAGG No data
971154637_971154638 -9 Left 971154637 4:24068318-24068340 CCTGTCAGAGAGAACAGTATCTG No data
Right 971154638 4:24068332-24068354 CAGTATCTGCAGAAGCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971154638 Original CRISPR CAGTATCTGCAGAAGCCCAG AGG Intergenic
No off target data available for this crispr