ID: 971155625

View in Genome Browser
Species Human (GRCh38)
Location 4:24078621-24078643
Sequence GCTCATAAATTGAAGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971155625_971155627 -8 Left 971155625 4:24078621-24078643 CCTTCTACCTTCAATTTATGAGC No data
Right 971155627 4:24078636-24078658 TTATGAGCATTTCCAGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971155625 Original CRISPR GCTCATAAATTGAAGGTAGA AGG (reversed) Intergenic
No off target data available for this crispr