ID: 971155627

View in Genome Browser
Species Human (GRCh38)
Location 4:24078636-24078658
Sequence TTATGAGCATTTCCAGAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971155625_971155627 -8 Left 971155625 4:24078621-24078643 CCTTCTACCTTCAATTTATGAGC No data
Right 971155627 4:24078636-24078658 TTATGAGCATTTCCAGAATTTGG No data
971155622_971155627 19 Left 971155622 4:24078594-24078616 CCTGTTTTCACTCTGACCCGTAT No data
Right 971155627 4:24078636-24078658 TTATGAGCATTTCCAGAATTTGG No data
971155624_971155627 2 Left 971155624 4:24078611-24078633 CCGTATCTCACCTTCTACCTTCA No data
Right 971155627 4:24078636-24078658 TTATGAGCATTTCCAGAATTTGG No data
971155623_971155627 3 Left 971155623 4:24078610-24078632 CCCGTATCTCACCTTCTACCTTC No data
Right 971155627 4:24078636-24078658 TTATGAGCATTTCCAGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971155627 Original CRISPR TTATGAGCATTTCCAGAATT TGG Intergenic
No off target data available for this crispr