ID: 971155627 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:24078636-24078658 |
Sequence | TTATGAGCATTTCCAGAATT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
971155625_971155627 | -8 | Left | 971155625 | 4:24078621-24078643 | CCTTCTACCTTCAATTTATGAGC | No data | ||
Right | 971155627 | 4:24078636-24078658 | TTATGAGCATTTCCAGAATTTGG | No data | ||||
971155622_971155627 | 19 | Left | 971155622 | 4:24078594-24078616 | CCTGTTTTCACTCTGACCCGTAT | No data | ||
Right | 971155627 | 4:24078636-24078658 | TTATGAGCATTTCCAGAATTTGG | No data | ||||
971155624_971155627 | 2 | Left | 971155624 | 4:24078611-24078633 | CCGTATCTCACCTTCTACCTTCA | No data | ||
Right | 971155627 | 4:24078636-24078658 | TTATGAGCATTTCCAGAATTTGG | No data | ||||
971155623_971155627 | 3 | Left | 971155623 | 4:24078610-24078632 | CCCGTATCTCACCTTCTACCTTC | No data | ||
Right | 971155627 | 4:24078636-24078658 | TTATGAGCATTTCCAGAATTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
971155627 | Original CRISPR | TTATGAGCATTTCCAGAATT TGG | Intergenic | ||
No off target data available for this crispr |