ID: 971158627

View in Genome Browser
Species Human (GRCh38)
Location 4:24109885-24109907
Sequence TGTCCTCCAGCTACTGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971158620_971158627 27 Left 971158620 4:24109835-24109857 CCGTGGTCTACCTTTGCTTCCTT No data
Right 971158627 4:24109885-24109907 TGTCCTCCAGCTACTGCAGATGG No data
971158624_971158627 8 Left 971158624 4:24109854-24109876 CCTTAGAAGTGGTGGAGCAGAGC No data
Right 971158627 4:24109885-24109907 TGTCCTCCAGCTACTGCAGATGG No data
971158622_971158627 17 Left 971158622 4:24109845-24109867 CCTTTGCTTCCTTAGAAGTGGTG No data
Right 971158627 4:24109885-24109907 TGTCCTCCAGCTACTGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971158627 Original CRISPR TGTCCTCCAGCTACTGCAGA TGG Intergenic
No off target data available for this crispr