ID: 971160451

View in Genome Browser
Species Human (GRCh38)
Location 4:24128267-24128289
Sequence TAATGTCTCCATTTTAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971160451_971160452 0 Left 971160451 4:24128267-24128289 CCTTCTTTAAAATGGAGACATTA No data
Right 971160452 4:24128290-24128312 ATACTAGCATATATCTTATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971160451 Original CRISPR TAATGTCTCCATTTTAAAGA AGG (reversed) Intergenic
No off target data available for this crispr