ID: 971160452

View in Genome Browser
Species Human (GRCh38)
Location 4:24128290-24128312
Sequence ATACTAGCATATATCTTATA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971160449_971160452 17 Left 971160449 4:24128250-24128272 CCTGTGACTCAGTTTTTCCTTCT No data
Right 971160452 4:24128290-24128312 ATACTAGCATATATCTTATACGG No data
971160451_971160452 0 Left 971160451 4:24128267-24128289 CCTTCTTTAAAATGGAGACATTA No data
Right 971160452 4:24128290-24128312 ATACTAGCATATATCTTATACGG No data
971160448_971160452 18 Left 971160448 4:24128249-24128271 CCCTGTGACTCAGTTTTTCCTTC No data
Right 971160452 4:24128290-24128312 ATACTAGCATATATCTTATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971160452 Original CRISPR ATACTAGCATATATCTTATA CGG Intergenic
No off target data available for this crispr