ID: 971160983

View in Genome Browser
Species Human (GRCh38)
Location 4:24133822-24133844
Sequence GCACCTAGCAAATATTAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971160983_971160987 9 Left 971160983 4:24133822-24133844 CCCAGTTAATATTTGCTAGGTGC No data
Right 971160987 4:24133854-24133876 TAGAATAAGGAGCAAACTTGAGG No data
971160983_971160985 -4 Left 971160983 4:24133822-24133844 CCCAGTTAATATTTGCTAGGTGC No data
Right 971160985 4:24133841-24133863 GTGCTCCTTCTACTAGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971160983 Original CRISPR GCACCTAGCAAATATTAACT GGG (reversed) Intergenic
No off target data available for this crispr