ID: 971165139

View in Genome Browser
Species Human (GRCh38)
Location 4:24175132-24175154
Sequence GTAAATGATATGTTTTCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971165139_971165143 3 Left 971165139 4:24175132-24175154 CCATTAGAAAACATATCATTTAC No data
Right 971165143 4:24175158-24175180 ATAGACTAAAATGGACCCCAAGG No data
971165139_971165140 -6 Left 971165139 4:24175132-24175154 CCATTAGAAAACATATCATTTAC No data
Right 971165140 4:24175149-24175171 ATTTACCCAATAGACTAAAATGG No data
971165139_971165147 23 Left 971165139 4:24175132-24175154 CCATTAGAAAACATATCATTTAC No data
Right 971165147 4:24175178-24175200 AGGAGCTATTCTAGTCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971165139 Original CRISPR GTAAATGATATGTTTTCTAA TGG (reversed) Intergenic