ID: 971165139 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:24175132-24175154 |
| Sequence | GTAAATGATATGTTTTCTAA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 971165139_971165147 | 23 | Left | 971165139 | 4:24175132-24175154 | CCATTAGAAAACATATCATTTAC | No data | ||
| Right | 971165147 | 4:24175178-24175200 | AGGAGCTATTCTAGTCTATCAGG | No data | ||||
| 971165139_971165143 | 3 | Left | 971165139 | 4:24175132-24175154 | CCATTAGAAAACATATCATTTAC | No data | ||
| Right | 971165143 | 4:24175158-24175180 | ATAGACTAAAATGGACCCCAAGG | No data | ||||
| 971165139_971165140 | -6 | Left | 971165139 | 4:24175132-24175154 | CCATTAGAAAACATATCATTTAC | No data | ||
| Right | 971165140 | 4:24175149-24175171 | ATTTACCCAATAGACTAAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 971165139 | Original CRISPR | GTAAATGATATGTTTTCTAA TGG (reversed) | Intergenic | ||