ID: 971165140

View in Genome Browser
Species Human (GRCh38)
Location 4:24175149-24175171
Sequence ATTTACCCAATAGACTAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971165139_971165140 -6 Left 971165139 4:24175132-24175154 CCATTAGAAAACATATCATTTAC No data
Right 971165140 4:24175149-24175171 ATTTACCCAATAGACTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971165140 Original CRISPR ATTTACCCAATAGACTAAAA TGG Intergenic
No off target data available for this crispr