ID: 971165141

View in Genome Browser
Species Human (GRCh38)
Location 4:24175154-24175176
Sequence GGGGTCCATTTTAGTCTATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971165141_971165149 11 Left 971165141 4:24175154-24175176 CCCAATAGACTAAAATGGACCCC No data
Right 971165149 4:24175188-24175210 CTAGTCTATCAGGTAATTATGGG No data
971165141_971165148 10 Left 971165141 4:24175154-24175176 CCCAATAGACTAAAATGGACCCC No data
Right 971165148 4:24175187-24175209 TCTAGTCTATCAGGTAATTATGG No data
971165141_971165147 1 Left 971165141 4:24175154-24175176 CCCAATAGACTAAAATGGACCCC No data
Right 971165147 4:24175178-24175200 AGGAGCTATTCTAGTCTATCAGG No data
971165141_971165151 13 Left 971165141 4:24175154-24175176 CCCAATAGACTAAAATGGACCCC No data
Right 971165151 4:24175190-24175212 AGTCTATCAGGTAATTATGGGGG No data
971165141_971165150 12 Left 971165141 4:24175154-24175176 CCCAATAGACTAAAATGGACCCC No data
Right 971165150 4:24175189-24175211 TAGTCTATCAGGTAATTATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971165141 Original CRISPR GGGGTCCATTTTAGTCTATT GGG (reversed) Intergenic
No off target data available for this crispr