ID: 971165142

View in Genome Browser
Species Human (GRCh38)
Location 4:24175155-24175177
Sequence TGGGGTCCATTTTAGTCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971165142_971165147 0 Left 971165142 4:24175155-24175177 CCAATAGACTAAAATGGACCCCA No data
Right 971165147 4:24175178-24175200 AGGAGCTATTCTAGTCTATCAGG No data
971165142_971165150 11 Left 971165142 4:24175155-24175177 CCAATAGACTAAAATGGACCCCA No data
Right 971165150 4:24175189-24175211 TAGTCTATCAGGTAATTATGGGG No data
971165142_971165148 9 Left 971165142 4:24175155-24175177 CCAATAGACTAAAATGGACCCCA No data
Right 971165148 4:24175187-24175209 TCTAGTCTATCAGGTAATTATGG No data
971165142_971165151 12 Left 971165142 4:24175155-24175177 CCAATAGACTAAAATGGACCCCA No data
Right 971165151 4:24175190-24175212 AGTCTATCAGGTAATTATGGGGG No data
971165142_971165149 10 Left 971165142 4:24175155-24175177 CCAATAGACTAAAATGGACCCCA No data
Right 971165149 4:24175188-24175210 CTAGTCTATCAGGTAATTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971165142 Original CRISPR TGGGGTCCATTTTAGTCTAT TGG (reversed) Intergenic
No off target data available for this crispr