ID: 971165143

View in Genome Browser
Species Human (GRCh38)
Location 4:24175158-24175180
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971165139_971165143 3 Left 971165139 4:24175132-24175154 CCATTAGAAAACATATCATTTAC No data
Right 971165143 4:24175158-24175180 ATAGACTAAAATGGACCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr