ID: 971165145

View in Genome Browser
Species Human (GRCh38)
Location 4:24175174-24175196
Sequence ATAGACTAGAATAGCTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971165145_971165148 -10 Left 971165145 4:24175174-24175196 CCCAAGGAGCTATTCTAGTCTAT No data
Right 971165148 4:24175187-24175209 TCTAGTCTATCAGGTAATTATGG No data
971165145_971165150 -8 Left 971165145 4:24175174-24175196 CCCAAGGAGCTATTCTAGTCTAT No data
Right 971165150 4:24175189-24175211 TAGTCTATCAGGTAATTATGGGG No data
971165145_971165152 14 Left 971165145 4:24175174-24175196 CCCAAGGAGCTATTCTAGTCTAT No data
Right 971165152 4:24175211-24175233 GGAAACCTTGTATTATTTACTGG No data
971165145_971165154 23 Left 971165145 4:24175174-24175196 CCCAAGGAGCTATTCTAGTCTAT No data
Right 971165154 4:24175220-24175242 GTATTATTTACTGGAGAAAATGG No data
971165145_971165149 -9 Left 971165145 4:24175174-24175196 CCCAAGGAGCTATTCTAGTCTAT No data
Right 971165149 4:24175188-24175210 CTAGTCTATCAGGTAATTATGGG No data
971165145_971165151 -7 Left 971165145 4:24175174-24175196 CCCAAGGAGCTATTCTAGTCTAT No data
Right 971165151 4:24175190-24175212 AGTCTATCAGGTAATTATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971165145 Original CRISPR ATAGACTAGAATAGCTCCTT GGG (reversed) Intergenic
No off target data available for this crispr