ID: 971165146

View in Genome Browser
Species Human (GRCh38)
Location 4:24175175-24175197
Sequence GATAGACTAGAATAGCTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971165146_971165154 22 Left 971165146 4:24175175-24175197 CCAAGGAGCTATTCTAGTCTATC No data
Right 971165154 4:24175220-24175242 GTATTATTTACTGGAGAAAATGG No data
971165146_971165152 13 Left 971165146 4:24175175-24175197 CCAAGGAGCTATTCTAGTCTATC No data
Right 971165152 4:24175211-24175233 GGAAACCTTGTATTATTTACTGG No data
971165146_971165150 -9 Left 971165146 4:24175175-24175197 CCAAGGAGCTATTCTAGTCTATC No data
Right 971165150 4:24175189-24175211 TAGTCTATCAGGTAATTATGGGG No data
971165146_971165151 -8 Left 971165146 4:24175175-24175197 CCAAGGAGCTATTCTAGTCTATC No data
Right 971165151 4:24175190-24175212 AGTCTATCAGGTAATTATGGGGG No data
971165146_971165149 -10 Left 971165146 4:24175175-24175197 CCAAGGAGCTATTCTAGTCTATC No data
Right 971165149 4:24175188-24175210 CTAGTCTATCAGGTAATTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971165146 Original CRISPR GATAGACTAGAATAGCTCCT TGG (reversed) Intergenic
No off target data available for this crispr