ID: 971165147

View in Genome Browser
Species Human (GRCh38)
Location 4:24175178-24175200
Sequence AGGAGCTATTCTAGTCTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971165139_971165147 23 Left 971165139 4:24175132-24175154 CCATTAGAAAACATATCATTTAC No data
Right 971165147 4:24175178-24175200 AGGAGCTATTCTAGTCTATCAGG No data
971165142_971165147 0 Left 971165142 4:24175155-24175177 CCAATAGACTAAAATGGACCCCA No data
Right 971165147 4:24175178-24175200 AGGAGCTATTCTAGTCTATCAGG No data
971165141_971165147 1 Left 971165141 4:24175154-24175176 CCCAATAGACTAAAATGGACCCC No data
Right 971165147 4:24175178-24175200 AGGAGCTATTCTAGTCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971165147 Original CRISPR AGGAGCTATTCTAGTCTATC AGG Intergenic
No off target data available for this crispr