ID: 971165151

View in Genome Browser
Species Human (GRCh38)
Location 4:24175190-24175212
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971165146_971165151 -8 Left 971165146 4:24175175-24175197 CCAAGGAGCTATTCTAGTCTATC No data
Right 971165151 4:24175190-24175212 AGTCTATCAGGTAATTATGGGGG No data
971165141_971165151 13 Left 971165141 4:24175154-24175176 CCCAATAGACTAAAATGGACCCC No data
Right 971165151 4:24175190-24175212 AGTCTATCAGGTAATTATGGGGG No data
971165144_971165151 -6 Left 971165144 4:24175173-24175195 CCCCAAGGAGCTATTCTAGTCTA No data
Right 971165151 4:24175190-24175212 AGTCTATCAGGTAATTATGGGGG No data
971165145_971165151 -7 Left 971165145 4:24175174-24175196 CCCAAGGAGCTATTCTAGTCTAT No data
Right 971165151 4:24175190-24175212 AGTCTATCAGGTAATTATGGGGG No data
971165142_971165151 12 Left 971165142 4:24175155-24175177 CCAATAGACTAAAATGGACCCCA No data
Right 971165151 4:24175190-24175212 AGTCTATCAGGTAATTATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr