ID: 971165154

View in Genome Browser
Species Human (GRCh38)
Location 4:24175220-24175242
Sequence GTATTATTTACTGGAGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971165146_971165154 22 Left 971165146 4:24175175-24175197 CCAAGGAGCTATTCTAGTCTATC No data
Right 971165154 4:24175220-24175242 GTATTATTTACTGGAGAAAATGG No data
971165144_971165154 24 Left 971165144 4:24175173-24175195 CCCCAAGGAGCTATTCTAGTCTA No data
Right 971165154 4:24175220-24175242 GTATTATTTACTGGAGAAAATGG No data
971165145_971165154 23 Left 971165145 4:24175174-24175196 CCCAAGGAGCTATTCTAGTCTAT No data
Right 971165154 4:24175220-24175242 GTATTATTTACTGGAGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971165154 Original CRISPR GTATTATTTACTGGAGAAAA TGG Intergenic
No off target data available for this crispr