ID: 971167705 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:24201406-24201428 |
Sequence | GTGAACAACACCCAGGTGGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
971167705_971167710 | 19 | Left | 971167705 | 4:24201406-24201428 | CCCTCCACCTGGGTGTTGTTCAC | No data | ||
Right | 971167710 | 4:24201448-24201470 | TAAAGTCATATTGATTATTGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
971167705 | Original CRISPR | GTGAACAACACCCAGGTGGA GGG (reversed) | Intergenic | ||
No off target data available for this crispr |