ID: 971167705

View in Genome Browser
Species Human (GRCh38)
Location 4:24201406-24201428
Sequence GTGAACAACACCCAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971167705_971167710 19 Left 971167705 4:24201406-24201428 CCCTCCACCTGGGTGTTGTTCAC No data
Right 971167710 4:24201448-24201470 TAAAGTCATATTGATTATTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971167705 Original CRISPR GTGAACAACACCCAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr