ID: 971167710

View in Genome Browser
Species Human (GRCh38)
Location 4:24201448-24201470
Sequence TAAAGTCATATTGATTATTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971167705_971167710 19 Left 971167705 4:24201406-24201428 CCCTCCACCTGGGTGTTGTTCAC No data
Right 971167710 4:24201448-24201470 TAAAGTCATATTGATTATTGCGG No data
971167706_971167710 18 Left 971167706 4:24201407-24201429 CCTCCACCTGGGTGTTGTTCACG No data
Right 971167710 4:24201448-24201470 TAAAGTCATATTGATTATTGCGG No data
971167707_971167710 15 Left 971167707 4:24201410-24201432 CCACCTGGGTGTTGTTCACGAGC No data
Right 971167710 4:24201448-24201470 TAAAGTCATATTGATTATTGCGG No data
971167708_971167710 12 Left 971167708 4:24201413-24201435 CCTGGGTGTTGTTCACGAGCAGA No data
Right 971167710 4:24201448-24201470 TAAAGTCATATTGATTATTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971167710 Original CRISPR TAAAGTCATATTGATTATTG CGG Intergenic
No off target data available for this crispr