ID: 971169763

View in Genome Browser
Species Human (GRCh38)
Location 4:24221264-24221286
Sequence CAATTTATTGAACACTTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971169761_971169763 22 Left 971169761 4:24221219-24221241 CCTTAAATTTTTACTATATTTTA No data
Right 971169763 4:24221264-24221286 CAATTTATTGAACACTTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971169763 Original CRISPR CAATTTATTGAACACTTACC AGG Intergenic
No off target data available for this crispr