ID: 971170893

View in Genome Browser
Species Human (GRCh38)
Location 4:24231473-24231495
Sequence ATGAGTCACTCTGGGCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971170893_971170899 7 Left 971170893 4:24231473-24231495 CCTCAAGGCCCAGAGTGACTCAT No data
Right 971170899 4:24231503-24231525 GACCCAAGCCCAGAAATCTTAGG No data
971170893_971170902 13 Left 971170893 4:24231473-24231495 CCTCAAGGCCCAGAGTGACTCAT No data
Right 971170902 4:24231509-24231531 AGCCCAGAAATCTTAGGAGATGG No data
971170893_971170905 27 Left 971170893 4:24231473-24231495 CCTCAAGGCCCAGAGTGACTCAT No data
Right 971170905 4:24231523-24231545 AGGAGATGGAGTTCATGTTTTGG No data
971170893_971170906 28 Left 971170893 4:24231473-24231495 CCTCAAGGCCCAGAGTGACTCAT No data
Right 971170906 4:24231524-24231546 GGAGATGGAGTTCATGTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971170893 Original CRISPR ATGAGTCACTCTGGGCCTTG AGG (reversed) Intergenic