ID: 971170894

View in Genome Browser
Species Human (GRCh38)
Location 4:24231481-24231503
Sequence CCTTTGGGATGAGTCACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971170894_971170906 20 Left 971170894 4:24231481-24231503 CCCAGAGTGACTCATCCCAAAGG No data
Right 971170906 4:24231524-24231546 GGAGATGGAGTTCATGTTTTGGG No data
971170894_971170899 -1 Left 971170894 4:24231481-24231503 CCCAGAGTGACTCATCCCAAAGG No data
Right 971170899 4:24231503-24231525 GACCCAAGCCCAGAAATCTTAGG No data
971170894_971170905 19 Left 971170894 4:24231481-24231503 CCCAGAGTGACTCATCCCAAAGG No data
Right 971170905 4:24231523-24231545 AGGAGATGGAGTTCATGTTTTGG No data
971170894_971170902 5 Left 971170894 4:24231481-24231503 CCCAGAGTGACTCATCCCAAAGG No data
Right 971170902 4:24231509-24231531 AGCCCAGAAATCTTAGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971170894 Original CRISPR CCTTTGGGATGAGTCACTCT GGG (reversed) Intergenic