ID: 971170896

View in Genome Browser
Species Human (GRCh38)
Location 4:24231482-24231504
Sequence TCCTTTGGGATGAGTCACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971170896_971170906 19 Left 971170896 4:24231482-24231504 CCAGAGTGACTCATCCCAAAGGA No data
Right 971170906 4:24231524-24231546 GGAGATGGAGTTCATGTTTTGGG No data
971170896_971170905 18 Left 971170896 4:24231482-24231504 CCAGAGTGACTCATCCCAAAGGA No data
Right 971170905 4:24231523-24231545 AGGAGATGGAGTTCATGTTTTGG No data
971170896_971170902 4 Left 971170896 4:24231482-24231504 CCAGAGTGACTCATCCCAAAGGA No data
Right 971170902 4:24231509-24231531 AGCCCAGAAATCTTAGGAGATGG No data
971170896_971170899 -2 Left 971170896 4:24231482-24231504 CCAGAGTGACTCATCCCAAAGGA No data
Right 971170899 4:24231503-24231525 GACCCAAGCCCAGAAATCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971170896 Original CRISPR TCCTTTGGGATGAGTCACTC TGG (reversed) Intergenic