ID: 971170897

View in Genome Browser
Species Human (GRCh38)
Location 4:24231496-24231518
Sequence TTTCTGGGCTTGGGTCCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971170897_971170908 26 Left 971170897 4:24231496-24231518 CCCAAAGGACCCAAGCCCAGAAA No data
Right 971170908 4:24231545-24231567 GGACTTTACCCAGGCAACAAAGG No data
971170897_971170907 17 Left 971170897 4:24231496-24231518 CCCAAAGGACCCAAGCCCAGAAA No data
Right 971170907 4:24231536-24231558 CATGTTTTGGGACTTTACCCAGG No data
971170897_971170902 -10 Left 971170897 4:24231496-24231518 CCCAAAGGACCCAAGCCCAGAAA No data
Right 971170902 4:24231509-24231531 AGCCCAGAAATCTTAGGAGATGG No data
971170897_971170906 5 Left 971170897 4:24231496-24231518 CCCAAAGGACCCAAGCCCAGAAA No data
Right 971170906 4:24231524-24231546 GGAGATGGAGTTCATGTTTTGGG No data
971170897_971170905 4 Left 971170897 4:24231496-24231518 CCCAAAGGACCCAAGCCCAGAAA No data
Right 971170905 4:24231523-24231545 AGGAGATGGAGTTCATGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971170897 Original CRISPR TTTCTGGGCTTGGGTCCTTT GGG (reversed) Intergenic