ID: 971170898

View in Genome Browser
Species Human (GRCh38)
Location 4:24231497-24231519
Sequence ATTTCTGGGCTTGGGTCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971170898_971170905 3 Left 971170898 4:24231497-24231519 CCAAAGGACCCAAGCCCAGAAAT No data
Right 971170905 4:24231523-24231545 AGGAGATGGAGTTCATGTTTTGG No data
971170898_971170908 25 Left 971170898 4:24231497-24231519 CCAAAGGACCCAAGCCCAGAAAT No data
Right 971170908 4:24231545-24231567 GGACTTTACCCAGGCAACAAAGG No data
971170898_971170906 4 Left 971170898 4:24231497-24231519 CCAAAGGACCCAAGCCCAGAAAT No data
Right 971170906 4:24231524-24231546 GGAGATGGAGTTCATGTTTTGGG No data
971170898_971170907 16 Left 971170898 4:24231497-24231519 CCAAAGGACCCAAGCCCAGAAAT No data
Right 971170907 4:24231536-24231558 CATGTTTTGGGACTTTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971170898 Original CRISPR ATTTCTGGGCTTGGGTCCTT TGG (reversed) Intergenic