ID: 971170900

View in Genome Browser
Species Human (GRCh38)
Location 4:24231505-24231527
Sequence CTCCTAAGATTTCTGGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971170900_971170908 17 Left 971170900 4:24231505-24231527 CCCAAGCCCAGAAATCTTAGGAG No data
Right 971170908 4:24231545-24231567 GGACTTTACCCAGGCAACAAAGG No data
971170900_971170906 -4 Left 971170900 4:24231505-24231527 CCCAAGCCCAGAAATCTTAGGAG No data
Right 971170906 4:24231524-24231546 GGAGATGGAGTTCATGTTTTGGG No data
971170900_971170907 8 Left 971170900 4:24231505-24231527 CCCAAGCCCAGAAATCTTAGGAG No data
Right 971170907 4:24231536-24231558 CATGTTTTGGGACTTTACCCAGG No data
971170900_971170905 -5 Left 971170900 4:24231505-24231527 CCCAAGCCCAGAAATCTTAGGAG No data
Right 971170905 4:24231523-24231545 AGGAGATGGAGTTCATGTTTTGG No data
971170900_971170912 28 Left 971170900 4:24231505-24231527 CCCAAGCCCAGAAATCTTAGGAG No data
Right 971170912 4:24231556-24231578 AGGCAACAAAGGTTTCCGGAAGG No data
971170900_971170909 24 Left 971170900 4:24231505-24231527 CCCAAGCCCAGAAATCTTAGGAG No data
Right 971170909 4:24231552-24231574 ACCCAGGCAACAAAGGTTTCCGG No data
971170900_971170913 29 Left 971170900 4:24231505-24231527 CCCAAGCCCAGAAATCTTAGGAG No data
Right 971170913 4:24231557-24231579 GGCAACAAAGGTTTCCGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971170900 Original CRISPR CTCCTAAGATTTCTGGGCTT GGG (reversed) Intergenic