ID: 971170903

View in Genome Browser
Species Human (GRCh38)
Location 4:24231511-24231533
Sequence CTCCATCTCCTAAGATTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971170903_971170909 18 Left 971170903 4:24231511-24231533 CCCAGAAATCTTAGGAGATGGAG No data
Right 971170909 4:24231552-24231574 ACCCAGGCAACAAAGGTTTCCGG No data
971170903_971170913 23 Left 971170903 4:24231511-24231533 CCCAGAAATCTTAGGAGATGGAG No data
Right 971170913 4:24231557-24231579 GGCAACAAAGGTTTCCGGAAGGG No data
971170903_971170907 2 Left 971170903 4:24231511-24231533 CCCAGAAATCTTAGGAGATGGAG No data
Right 971170907 4:24231536-24231558 CATGTTTTGGGACTTTACCCAGG No data
971170903_971170908 11 Left 971170903 4:24231511-24231533 CCCAGAAATCTTAGGAGATGGAG No data
Right 971170908 4:24231545-24231567 GGACTTTACCCAGGCAACAAAGG No data
971170903_971170912 22 Left 971170903 4:24231511-24231533 CCCAGAAATCTTAGGAGATGGAG No data
Right 971170912 4:24231556-24231578 AGGCAACAAAGGTTTCCGGAAGG No data
971170903_971170906 -10 Left 971170903 4:24231511-24231533 CCCAGAAATCTTAGGAGATGGAG No data
Right 971170906 4:24231524-24231546 GGAGATGGAGTTCATGTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971170903 Original CRISPR CTCCATCTCCTAAGATTTCT GGG (reversed) Intergenic