ID: 971170904

View in Genome Browser
Species Human (GRCh38)
Location 4:24231512-24231534
Sequence ACTCCATCTCCTAAGATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971170904_971170907 1 Left 971170904 4:24231512-24231534 CCAGAAATCTTAGGAGATGGAGT No data
Right 971170907 4:24231536-24231558 CATGTTTTGGGACTTTACCCAGG No data
971170904_971170912 21 Left 971170904 4:24231512-24231534 CCAGAAATCTTAGGAGATGGAGT No data
Right 971170912 4:24231556-24231578 AGGCAACAAAGGTTTCCGGAAGG No data
971170904_971170913 22 Left 971170904 4:24231512-24231534 CCAGAAATCTTAGGAGATGGAGT No data
Right 971170913 4:24231557-24231579 GGCAACAAAGGTTTCCGGAAGGG No data
971170904_971170909 17 Left 971170904 4:24231512-24231534 CCAGAAATCTTAGGAGATGGAGT No data
Right 971170909 4:24231552-24231574 ACCCAGGCAACAAAGGTTTCCGG No data
971170904_971170908 10 Left 971170904 4:24231512-24231534 CCAGAAATCTTAGGAGATGGAGT No data
Right 971170908 4:24231545-24231567 GGACTTTACCCAGGCAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971170904 Original CRISPR ACTCCATCTCCTAAGATTTC TGG (reversed) Intergenic