ID: 971170906

View in Genome Browser
Species Human (GRCh38)
Location 4:24231524-24231546
Sequence GGAGATGGAGTTCATGTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971170901_971170906 -5 Left 971170901 4:24231506-24231528 CCAAGCCCAGAAATCTTAGGAGA No data
Right 971170906 4:24231524-24231546 GGAGATGGAGTTCATGTTTTGGG No data
971170903_971170906 -10 Left 971170903 4:24231511-24231533 CCCAGAAATCTTAGGAGATGGAG No data
Right 971170906 4:24231524-24231546 GGAGATGGAGTTCATGTTTTGGG No data
971170898_971170906 4 Left 971170898 4:24231497-24231519 CCAAAGGACCCAAGCCCAGAAAT No data
Right 971170906 4:24231524-24231546 GGAGATGGAGTTCATGTTTTGGG No data
971170894_971170906 20 Left 971170894 4:24231481-24231503 CCCAGAGTGACTCATCCCAAAGG No data
Right 971170906 4:24231524-24231546 GGAGATGGAGTTCATGTTTTGGG No data
971170897_971170906 5 Left 971170897 4:24231496-24231518 CCCAAAGGACCCAAGCCCAGAAA No data
Right 971170906 4:24231524-24231546 GGAGATGGAGTTCATGTTTTGGG No data
971170896_971170906 19 Left 971170896 4:24231482-24231504 CCAGAGTGACTCATCCCAAAGGA No data
Right 971170906 4:24231524-24231546 GGAGATGGAGTTCATGTTTTGGG No data
971170900_971170906 -4 Left 971170900 4:24231505-24231527 CCCAAGCCCAGAAATCTTAGGAG No data
Right 971170906 4:24231524-24231546 GGAGATGGAGTTCATGTTTTGGG No data
971170893_971170906 28 Left 971170893 4:24231473-24231495 CCTCAAGGCCCAGAGTGACTCAT No data
Right 971170906 4:24231524-24231546 GGAGATGGAGTTCATGTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971170906 Original CRISPR GGAGATGGAGTTCATGTTTT GGG Intergenic